And the Spirit & the bride say, come.... Reveaaltion 22:17

And the Spirit & the bride say, come.... Reveaaltion 22:17
And the Spirit & the bride say, come...Revelation 22:17 - May We One Day Bow Down In The DUST At HIS FEET ...... {click on blog TITLE at top to refresh page}---QUESTION: ...when the Son of man cometh, shall he find faith on the earth? LUKE 18:8

Sunday, October 9, 2016

The Genesis Conflict Sermon SERIES by Walter Veith

The Genesis Conflict Sermon SERIES
(by Walter Veith)
 
For in six days the LORD made heaven and earth,
Exodus 20:11
From Evolutionist to Creationist {Testimony}
Where Mammals Reigned
Bones in Stones
Evidence for a Universal Flood
The Earth in Time and Space
A Day to be Remembered
Creation to Restoration
The Genes of Genesis
A Spade Unearths The Truth
Posted by at

SDA Issues - Why a Doctrinally Illiterate Generation?

Why a Doctrinally Illiterate Generation?...Because of certain rebellious leaders & faithless "shepherds"....
"Because of the systematic muting and changing of the distinctive messages given to Seventh-day Adventists, there exists today a
generation of Seventh-day Adventists, which can be traced to the time shortly after Ellen White had died, that know neither their history nor the messages that separate them from the fallen churches of Babylon, much like the times after Joshua died and it was stated, “And Joshua, the son of Nun, the servant of the LORD, died…And also all that generation were gathered unto their fathers: and there arose another generation after them, which knew not the LORD, nor yet the works which he had done for Israel” Joshua 2:8 and 10."
SavedToServe/Hilari Henriques
Posted by at

When Our Captain Says....

The hope which is laid up for you in heaven.
  Colossians 1:5
 
"Our hope in Christ for the future is the mainspring and the mainstay of our joy here.
 
Here we are weary and toilworn,
but yonder is the land of rest where the sweat of labor shall no more bedew the worker's brow, and fatigue shall be for ever banished.
 
To those who are weary and spent,
the word "rest" is full of heaven.
 
We are always in the field of battle;
we are so tempted within,
and so molested by foes without,
that we have little or no peace;
but in heaven we shall enjoy the victory,
when the banner shall be waved aloft in triumph,
and the sword shall be sheathed,
and we shall hear our Captain say,
"Well done, good and faithful servant."
Charles Spurgeon
Posted by at

Creation Moment 10/10/2016 - TRs

What sorrow awaits those who argue with their Creator.
Does a clay pot argue with its maker?
Does the clay dispute with the one who shapes it, saying,
‘Stop, you’re doing it wrong!’
Does the pot exclaim,
‘How clumsy can you be?
Isaiah 45:9 NLT
"One class of repetitious human genome sequences recently highlighted in the news is called tandem repeats (TRs). These are simply stretches of DNA comprised of two or more contiguous copies of a "word" (called a motif) arranged in a head-to-tail pattern.

For example, the TR "ttacttacttacttacgttac" is simply a repeat of the four-base motif "ttac" five times. Amazingly, these TRs are found all over the human genome: inside genes, outside genes, and even
inside the protein-coding regions of genes. Among individual humans, many TRs vary in the length of the repeat. They have been used in forensics as highly effective DNA markers to solve criminal and paternity cases.

Despite knowing about these TR sequences and using them as reliable genetic markers, scientists have known very little about their actual function. Historically, anomalies like these repeating sequences, that seem to make little sense upon first glance, were often relegated to the trash bin of "junk DNA."

However, one group of researchers recently took a different approach and hypothesized that these sequences may have a purpose. They developed a set of experiments to test the effect of TRs on gene expression and the epigenetic modification of DNA. Epigenetic modification is the addition of molecular tags to the DNA molecule without changing the actual DNA sequence. The result is altered gene expression.

As a consequence of extensive testing using both existing and newly generated data sets, the researchers proclaim, "Our results suggest that there are potentially thousands of TR variants in the human genome that exert functional effects via alterations of local gene expression or epigenetics." They also state,
Our study assigns biological significance to TR variations in the human genome, and suggests that a significant fraction of TR variations exert functional effects via alterations of local gene expression or epigenetics. We conclude that targeted studies that focus on genotyping [genetic testing] TR variants are required to fully ascertain functional variation in the genome.
 
These new data confirm a variety of previous studies that uncovered evidence of the functional role of TRs from their association with human diseases. As it turns out, several dozen heritable human diseases are directly associated with large repeat expansions in either coding or non-protein-coding regions of the genome.2

Clearly, these regions are under tight genetic control. When the repeats go outside their boundaries of allowable length variation, disease may be the result.

Once more we have a glaring example of demonstrated function in the genome for something once declared non-functional merely based on the fact that scientists didn't know its function—as if a lack of knowledge and understanding could somehow provide an adequate answer.

If a design-based approach were more widely taken during the course of genomic discovery, just think how much improvement would take place in our understanding of currently unknown features. Such an approach would also give glory to our great omnipotent Creator who is the Master Designer and Engineer of all life." ICR
Posted by at

Saturday, October 8, 2016

Repairing the Breach Sermon SERIES by Walter Veith

Repairing the Breach Sermon SERIES
(by Walter Veith)
 
The repairer of the breach,
The restorer of paths to dwell in.
Isaiah 58:12
Thou Shalt Call His Name Jesus
King of the North Part 1
King of the North - PART 2
Reaping the Whirlwind - Part 1
Reaping the Whirlwind - Part 2
Brass for Gold
Give Me This Mountain
King of the North Embracing World Religions
Foundations of Many Generations - Part 1
Foundations of Many Generations - Part 2
Announcements from Heaven
Elias
Repairing the Breach
Get Away from the Tents
The Threshing Floor
Posted by at

SDA News - A new addition

"Seventh-day Adventist leaders will declare that Adventist education is key to the fulfillment of the church’s mission to share the gospel and propose a 29th Fundamental Belief on education during a three-day conference that opens Wednesday evening at the world church’s headquarters.
The suggested addition to the current 28 Fundamental Beliefs, which would describe the biblical basis for Adventist education, is among a raft of plans for Adventist education that are to be presented to world church leaders at the LEAD conference in Silver Spring, Maryland.

The plan, which is outlined in a document that will be presented to conference attendees, calls for the:
  • establishment of measurable goals to increase the number of pre-kindergarten/elementary and secondary schools over the next five years;
  • establishment of measureable outcomes that raise the standard of academic excellence;
  • establishment of clear curriculum policies and indicators that position schools to nurture in the hearts of students a culture of church involvement and a broad spectrum of mission skills;
  • incorporation of resources of the Biblical Research Institute and the Geoscience Research Institute in the Accrediting Association of Seventh-day Adventist Schools, Colleges, and Universities (AAA) process that clearly requires all accredited schools to advocate for and teach as truth the Fundamental Beliefs as voted by the General Conference Session;
  • development of policy and criteria that define a new tier of Adventist education described as High Impact Schools (HIS).
  • definition and development of standards for other models of education, such as homeschools, residence hall non-degree awarding “college,” pastoral-led classes, online Massive Open Online Courses in a way that enables such students to be a part of Adventist education;
  • definition of the core of Adventist education at all levels and ensure alignment with AAA and HIS criteria, with latitude beyond threshold requirements; and
  • development of Fundamental Belief No. 29 describing the biblical basis for Seventh-day Adventist education." ANN
Train up a child in the way he should go:
Proverbs 22:6
Posted by at

Joel: Pentecost & the Latter Rain

....for he hath given you the former rain moderately,
and he will cause to come down for you the rain,
the former rain, and the latter rain .....
Joel 2:23
 
Joel & the Day of Pentecost:
And when the day of Pentecost was fully come,....Now when this was noised abroad,
 the multitude came together, and were confounded,
because that every man heard them speak in his own language.
But this is that which was spoken by the prophet Joel;
And it shall come to pass in the last days,
saith God,
I will pour out of my Spirit upon all flesh:
and your sons and your daughters shall prophesy,
and your young men shall see visions,
and your old men shall dream dreams:
And on my servants and on my handmaidens
I will pour out in those days of my Spirit; and they shall prophesy:
And I will shew wonders in heaven above, and signs in the earth beneath;
blood, and fire, and vapour of smoke:
The sun shall be turned into darkness,
and the moon into blood, before that great and notable day of the Lord come: And it shall come to pass, that whosoever shall call on the name of the Lord shall be saved.
Acts 2:1,6,16-21
 
Joel & the Latter Rain:
And it shall come to pass afterward,
that I will pour out my spirit upon all flesh;
and your sons and your daughters shall prophesy,
your old men shall dream dreams, your young men shall see visions:
And also upon the servants and upon the handmaids in those days will I pour out my spirit.
And I will shew wonders in the heavens and in the earth, blood, and fire, and pillars of smoke.
The sun shall be turned into darkness,
and the moon into blood, before the great and the terrible day of the LORD come.
And it shall come to pass, that whosoever shall call on the name of the LORD
shall be delivered:
Joel 2:28-32
Posted by at

Creation Moment 10/9/2016 - Creation in Joel

"Joel.
Within the “day of the Lord” imagery, Joel employs creation imagery in order to describe the impact of Yahweh’s theophany on creation as part of that judgment day: “The sun and moon will grow dark, and the stars will diminish their brightness. The Lord also will roar from Zion, and utter His voice from Jerusalem; the heavens and earth will shake; but the Lord will be a shelter for His people, and the strength of the children of Israel” (Joel 3:15, 16). “Heavens and earth” serves as a creation indicator, but again, within a negative context of judgment. The
theophanic event is always connected to the experience of God in nature and the impact of His appearance on creation.
        The final verses of Joel, however, return to the topic of re-creation describing the future of Zion in paradisiacal terms: “In that day . . . the mountains shall drip with new wine, the hills shall flow with milk, and all the brooks of Judah shall be flooded with water; a fountain shall flow from the house of the Lord and water the Valley of Acacias” (vs. 18). The Garden of Eden mentioned earlier  (2:3), which had been destroyed by the locust plague, is thus being re-created. Again, a linear motion from creation to de-creation and finally re-creation can be observed with creation being the overall paradigm that underlies history."
PerspectiveDigest
Posted by at

Friday, October 7, 2016

HE is CHRIST

If any man sin, we have an advocate with the Father, Jesus Christ the righteous...
  1 John 2:1
"If any man sin, we have an advocate."
 
 
John does not say, "If any man sin he has forfeited his advocate," but "we have an advocate," sinners though we are. 
 
 ....it is "Jesus Christ"-Christos, the anointed.
This shows His authority to plead.
 
The Christ has a right to plead,
for He is the Father's own appointed advocate and elected priest.
 
He is Christ,
and therefore authorized;
He is Christ,
and therefore qualified.
 
He declares Himself my substitute and puts His obedience to my account."
Charles Spurgeon
Posted by at

Eutychian Heresy in Modern Christendom


"Jory Micah is a feminist “theologian” who has risen to promote egalitarianism and women in

Jory Micah
leadership. Many times, Micah reads the Bible in light of her feminism and not the other way around. Such a reading of Scripture will not only lead to numerous heterodoxies but will cause someone to believe and teach heresy. This has happened many times with her theology.
A dissection of her Master’s Thesis will show a few troubling doctrines. Besides a poor handling of God’s Word and a few points that rely solely on creating confusion about the text of Scripture, one thing that stood out was in her introduction, when she said, “While Jesus walked the earth as a male, there is no biblical evidence that Jesus’ glorified body is still male in Heaven.” Either she is claiming that Jesus is a transgender or she is claiming that Jesus no longer has a human nature, the Eutychian heresy. Either way, that statement is a Christ-related (Christological) heresy.
God reveals Himself as a male. Every single pronoun used for any member of the Godhead is a masculine pronoun. However, Jory Micah says in her Master’s Thesis, “God is just as much a Mother as He is a Father.”  ...She makes the argument that the Hebrew word for spirit is a feminine noun, therefore the Holy Spirit must be female (By that same logic, sin is female, as the Hebrew word for sin is feminine).  God reveals Himself in the masculine, and that is because He is male. If you want to make the case that God is a female because He is compared to a female at times, you must also make the case that He is a chicken (Luke 13:34), a door (John 10:9), and a lion (Hosea 11:10)."
Pen&Pulpit
Much more then,
being now justified
by his blood,...
Romans 5:9
Posted by at

IN the NEWS - POLL: Confusion in Babylon

 .....Babylon is fallen, is fallen,....
Revelation 14:8
"The survey, commissioned by Ligonier Ministries, asked 3,000 participants a set of 47 questions about foundational Christian beliefs. Many of the answers revealed a mishmash of heresy and confusion about Christianity’s most basic doctrines.

Statement No. 6

God accepts the worship of all religions, including Christianity, Judaism and Islam.

Finding:
46% of self-identified evangelicals agree or somewhat agree with this statement.

Many Americans live with a great deal of theological confusion and even hold contradicting sets of beliefs. ----43% of people who agree that God is the author of Scripture also agreed that modern science discredits the claims of the Bible.

 Statement No. 39

Sex outside of traditional marriage is a sin.
Finding:
Only 52% of self-identified evengelicals who attend church once or twice per month strongly agree with this statement.

Statement No. 40

Abortion is a sin.
Finding:
Only 48% of self-identified evengelicals who attend church once or twice per month strongly agree with this statement.

Seventy percent of Americans agree there’s only one true God—one in essence, three in person: Father, Son and Holy Spirit. Yet almost the same number believe God accepts the worship of all other religions, even those that deny the Trinity or worship other deities. Sixty-one percent correctly say Jesus is both human and divine, but half think that He’s also “the first and greatest being created by God,” rather than existing eternally, as Scripture and the ancient creeds of the faith teach.
More bizarre contradictions emerged: Over sixty percent of Americans say that God, Who cannot err, is the Author of the Bible. Yet fewer than half are willing to affirm that the Bible God wrote is “one hundred percent accurate in all it teaches.” Two-thirds admit everyone sins, yet also insist that most people are good by nature! Perhaps most oddly, half of Americans believe that only those who accept Jesus will be saved, yet sixty percent also say everyone will eventually make it to Heaven.

Yet huge percentages of these folks appeared to affirm major tenets of ancient heresies like Arianism. An astonishing seventy percent, for instance, say Jesus is a created being. Fifty-six percent say the Third Person of the Trinity, the Holy Spirit, “is a divine force but not a personal being.”
 CNS
Posted by at

Examine Yourselves

"Much is said about the "abomination of desolation" by today's Christians, and with the book of Revelation open in one hand, and an eye to the news cycle on the other, believers look for an outsider to fill the role of antichrist—failing to recognize that internal
apostasy has always been the cause of desolation among God's people.
Last-day events will follow the past in their march toward the final crisis. It's the reason that the book of Revelation is carefully and deliberately composed with the language and symbols of the past  In the last days, when the world wonders after a resurrected beast, it will not be only the wickedness of other belief systems that made it possible; it will happen because the hearts of God's people have been desolate for a long time. 
It is one thing to notice the abominations of the world. It is quite another to do a personal inventory as Paul suggests: "Examine yourselves as to whether you are in the faith." 2 Corinthians 13:5"
ShawnBoonstra
Posted by at

IN the NEWS - Billy Graham is right ... but....

Billy Graham is right....--but--....one can see how this thinking, during an uptick in natural disasters of enormous magnitude, could be used as a call to turn the nation back to God (because of our moral rot) leading towards the formation of the mark-of-the-beast......just saying.....

"Pastor Billy Graham, one of the most respected and influential Christian evangelists of the last 60 years, said that God gave us “moral laws” about sex “that are absolute and unchangeable,” and for those who engage in sexual immorality, God’s “wrath” will fall on them and “upon those who encourage others to indulge in
immoral practices.”
“From the very beginning, God has given us moral laws governing the subject of sex that are absolute and unchangeable,” said Pastor Billy Graham in a radio broadcast that was re-published in the September issue of Decision magazine.  “Nowhere does the Bible teach that sex in itself is a sin. But from Genesis to Revelation, the Bible condemns the wrong use of sex.”
“According to the Bible, morals are not relative. They are absolute,” said Pastor Graham. “There is noting in the Bible that would lead us to believe that God has ever lowered His standards. The seventh commandment says, ‘You shall not commit adultery’ Exodus 20:14.”
Pastor Graham continued, “God has not changed. What was wrong from the beginning is still wrong today in God’s sight. … He is absolute.”
“And I warn you that His wrath is going to explode upon those who are immoral and upon those who encourage others to indulge in immoral practices,” said Pastor Graham." CNS
 
Posted by at

Creation Moment 10/8/2016 - one for the good guys

"The microscopist fired for his publication of Darwin-embarrassing dinosaur soft tissue has won a historic settlement against Cal State University.

Exclusive: Mark Armitage tells CEH that his case against Cal State University Northridge (CSUN)
has resulted in a settlement after Judge Dalila Lyons of the California Superior Court ruled in a motion of adjudication favorable to his complaint. Rather than face a probable loss before a jury, CSUN’s lawyers chose to settle with him. Armitage writes:

It was not simply a motion for summary judgment that the judge ruled against. The judge ruled against them in a motion for adjudication. There’s a big difference. In other words the judge made a ruling on the case and as a trier of fact concluded that we proved our case that they discriminated against my religion and they failed to follow up or investigate a written complaint of religious discrimination. There was no sense for the University to be dragged into the jury trial because it was clear that they were going to lose at trial and the awards would have been much larger than they presently are.
 
According to FreedomX attorney Bill Becker, who litigated the Coppedge vs JPL case in 2012, a motion for adjudication means that the judge has confirmed certain evidence to be factual, and thus not in need of debate before a trier of fact. Said evidence can thus be stipulated as factual at the beginning of a court proceeding. Whatever the facts were, they must have been significant enough to scare CSUN’s attorneys from chancing a trial before a jury.

Mark was employed as a microscopist and lab instructor at the university, but was abruptly terminated in 2014 without explanation after he and Dr. Kevin Anderson published a paper in Acta Histochemica describing soft tissue they had found in a Triceratops horn in Montana. That paper mentioned nothing about intelligent design or creationism, but Mark is well known as a young earth creationist, being a board member of the Creation Research Society (CRS), along with Anderson. The case caught the attention of Nature (11/05/14). Finding intact soft tissue inside a dinosaur bone causes obvious problems with the geological time scale. Since his firing, Mark has continued electron-microscopy work on dinosaur soft tissue under the auspices of CRS." CEH
Thus saith the LORD, thy redeemer,
and he that formed thee from the womb,
I am the LORD that maketh all things;
that stretcheth forth the heavens alone;
that spreadeth abroad the earth by myself;
That frustrateth the tokens of the liars,
and maketh diviners mad; that turneth wise men backward,
and maketh their knowledge foolish;
Isaiah 44:24,25
Posted by at

Thursday, October 6, 2016

Total Transformation Sermon SERIES by Walter Veith

Total Transformation Sermon SERIES
(by Walter Veith)
And be not conformed to this world:
but be ye transformed by the renewing of your mind,
Romans 12:2
 
Co-dependence 
Thou art mine 
1844 in Type and Antitype 
1888 On The Borders Of Canaan 
No Time For Rebellion 
Nothing But This Manna
Look And Live
Baal - Peor
LAODICEA
Am I My Brother's Keeper?
Mordecai In The Gate
JEREMIAH Prophet Of Doom
HAGGAI A Call To Sanctification
NEHEMIAH Governor Of Israel
RUTH From Ashes To Glory
I Hear The Rumbling
I Hear An Abundance Of Rain
More Are The Children Of The Barren Woman
Posted by at

The Doctrine of the Few

The LORD did not set his love upon you, nor choose you,
because ye were more in number than any people;
for ye were the fewest of all people.
Deuteronomy 7:7

 "There were undoubtedly millions of people on the earth, for example, when the Flood came in the days of Noah, but only “few, that is, eight souls were saved” as the waters lifted up the Ark (1 Peter
3:20).
 
A few centuries after the Flood, populations had again increased, and great nations developed in Egypt, Sumeria, and elsewhere. But God called one man, Abraham, to establish a new nation, and he obeyed. Many great nations came from Abraham, but again God chose only one, Israel, to inherit the promise. Israel did grow, but as our text shows, even this chosen nation was nearly always insignificant compared to other nations.

In the New Testament, the Lord Jesus told His disciples that “where two or three are gathered together in my name, there am I in the midst of them” (Matthew 18:20).

God’s criterion is that of motivation rather than multiplication. “Strait is the gate, and narrow is the way, which leadeth unto life, and few there be that find it” (Matthew 7:14). But those few will be faithful servants and will someday hear Him say: “Well done, thou good and faithful servant . . . enter thou into the joy of thy Lord” (Matthew 25:21)." HMM
Posted by at

Creation Moment 10/7/2016 - Creation in Habakkuk

"Habakkuk.
Habakkuk offers a similar perspective on creation as Nahum in using creation imagery in the context of de-creation during the
theophany in the “day of the Lord”: “He stood and measured the earth; He looked and startled the nations. And the everlasting mountains were scattered, the perpetual hills bowed. His ways are everlasting” (Hab. 3:6). In the following verses, Habakkuk describes the impact of Yahweh’s appearance on creation (vss. 7-12). However, through the destructive power of de-creation, salvation is accomplished: “You went forth for the salvation of Your people, for salvation with Your Anointed” (vs. 13). Along the same lines, creation imagery also serves as a point of reference for recognition of the Creator: “The earth will be filled with the knowledge of the glory of the Lord, As the waters cover the sea” (2:14)."
PerspectiveDigest
Posted by at

Wednesday, October 5, 2016

IN the NEWS - Rising Soul DECEPTION

HERE WE GO.....Deception about the state of the dead (which are dead until the resurrection). This story illustrates, especially in the age of social media, how people can easily be DECEIVED.
Whether this was caused by something else, or was a delusion by the opponent of God, it is being touted in "Christian" circles to prove the unbiblical doctrine of the immortality of the soul.
.... if it were possible, they shall deceive the very elect.
Matthew 24:24

"CCTV footage recording a busy road captured the moment a woman's soul leaped from her body following a fatal accident.
As a blue truck slowly eases its way into the road, a woman on a motorcycle zooms by and clips the
front bumper.
She is immediately thrown from her bike, which tears to pieces, flies against a pole and lands on the motorcycle on the side of the road.
The truck comes to a complete stop after entering the entrance of the parking lot as an eerie image of what appears to be a woman in a black dress appears just above the woman's broken body.
The passenger steps from the truck and a man holding a sign joins the passenger as they rush to the fallen woman.
More witnesses run up to her and stand around the body, seemingly unable to detect the shadowy figure, which appears to be a confused woman.
The shadow flickers then fades to nothing as witnesses begin to panic.
What was the shadowy figure?
Some believe it was the woman's soul, thrown from her body when she died.
Rather than ascending straight to the afterlife, her confused soul remains behind long enough to understand it is no longer attached to a living body so it accepts its fate and moves on."
CatholicOnline
Posted by at

Job on the Judgment

Also now, behold,
my witness is in heaven,
and my record is on high.
Job 16:19
---WAITING FOR---
A fiery stream issued and came forth from before him: thousand thousands ministered unto him,
and ten thousand times ten thousand stood before him:
the judgment was set,
and the books were opened.
Daniel 7:10
Posted by at

Creation Moment 10/6/2016 - Uhm.. "Motors"?

Flagellum Focus
"Back in the 1990s, Behe relied on relatively crude electron micrographs of flagella. Imagine twenty years ago if he had been able to see in detail one protein in the stator of the flagellum. That's what Japanese scientists from Nagoya University revealed with advanced imaging techniques. So has the case for design grown stronger or weaker since Darwin's Black Box was published? A paper in Nature's open-access journal Scientific Reports reveals the answer. You can see their composite image of the stator protein MotA here:

It looks more like a well-designed outboard motor than ever!

Many bacterial species use spiral propellers (flagella) attached to motors to move through a liquid environment. An interaction between the rotor and stator components of the motor generates the rotational force required for movement. The stator converts electrochemical energy into mechanical force after undergoing a structural change caused by a movement of charged particles (ions) through an internal channel. Previous studies investigated the stator and its interaction with the rotor by constructing mutant proteins and analyzing their functions. However, little was known about stator structure.
A team of Japanese researchers led by Homma's laboratory of Nagoya University have now purified the stator protein MotA from a bacterium found in hot springs (Aquifex aeolicus) and analyzed its three-dimensional structure using electron microscopy mainly in cooperation with Namba's laboratory of Osaka University.

The stator protein MotA shows an elegantly crafted channel for ions. These are arranged in groups of four at the base of the stator on the cytoplasmic side. Two slender molecules of MotB extend into the periplasm. Identifying the structure is an important step on the way to figuring out how the flagellum works." EN&V
"MOTORS"?
Thy hands have made me and fashioned me:
Psalm 119:73
Posted by at

Tuesday, October 4, 2016

Don't Hesitate

A man greatly beloved.
  Daniel 10:11
"Child of God,
do you hesitate to appropriate this title?
 
Ah! has your unbelief made you forget that you are greatly beloved
too? Must you not have been greatly beloved, to have been bought with the precious blood of Christ, as of a lamb without blemish and without spot? When God smote His only begotten Son for you, what was this but being greatly beloved?
 
 
You lived in sin, and rioted in it,
must you not have been greatly beloved
for God to have borne so patiently with you?
 
You were called by grace and led to a Savior,
and made a child of God and an heir of heaven. 
 
 If the Lord has chastened you, yet not in anger; if He has made you poor, yet in grace you have been rich. The more unworthy you feel yourself to be, the more evidence have you that nothing but unspeakable love could have led the Lord Jesus to save such a soul as yours. 
 
 Come boldly, O believer, for despite the whisperings of Satan and the doubtings of thine own heart, thou art greatly beloved. Meditate on the exceeding greatness and faithfulness of divine love this evening, and so go to thy bed in peace."
Charles Spurgeon
Posted by at

Papal Notes - Buddhist / Papal Alliance?

"The Pontifical Council for Interreligious Dialogue has sent a message to the Buddhists of the world to mark the Feast of Vesakh, which commemorates the his birth, enlightenment and death of
Gautama Buddha.
This year’s Message was inspired by Pope Francis’ Encyclical Laudato si’.
“As the crisis of climate change is contributed to by human activity, we, Christians and Buddhists, must work together to confront it with an ecological spirituality,” writes  Cardinal Jean-Louis Tauran, the President of the Pontifical Council. “The
acceleration of global environmental problems has added to the urgency of interreligious cooperation.”
Cardinal Tauran concludes by calling on Catholics and Buddhists to “cooperate together in liberating humanity from the suffering brought about by climate change, and contribute to the care of our common home.” VaticanRadio
 ...and all the world wondered after the beast.
Revelation 13:3
Posted by at

IN the NEWS - Norway allows CHILDREN to change "gender"

"Norwegians as young as 6 can now legally change their gender using an online form—without a doctor’s approval, counseling, or surgery.


The law, adopted with a 79-13 vote by the Norwegian parliament in June, makes Norway the fifth country in the world to pass a similar law, and the second behind Malta to include children. While the process in Malta requires a parent to seek court approval for the gender change, children in Norway apply for the change using the same process and paperwork as adults.

While transgender activists celebrated the new law, experts warn treating gender dysphoria so lightly could multiply harm for children who most likely will shed feelings of confusion as they become adults.

Under the law, a person who wants to identify as a gender that does not correspond to his or her biological sex must submit an online form and return a mailed letter confirming the decision. Once approved, the individual receives a new national identification number allowing him or her to update passport, driver’s license, birth certificate, credit cards, and other forms of identification. More than 250 Norwegians, including nine minors, have applied so far, and the government has accepted every application." CH


Foolishness is bound in the heart of a child;
Proverbs 22:15
Posted by at

Creation Moment 10/5/2016 - Perplexed Evolutionists

"Darren Curnoe.... He asks, “Why are there so many species of bugs, but so few species of human?” That question is enveloped in a larger question, “Looking around at the natural world, have you ever wondered why some groups of organisms contain huge numbers of species while others are
seemingly barren?” To both of these, Curnoe offers speculations, but no firm answers from an evolutionary viewpoint.

Just why some groups contain large numbers of species while others don’t has long puzzled biologists. One of the main explanations has been geological age — older groups of organisms are more diverse because they have simply had more time to accumulate greater numbers of species.
 
Yet, the fact remains that some comparatively young groups of species are remarkably diverse; and conversely, some like the Methanopyri are very ancient but species poor.
 
Curnoe also addresses the question of why sex evolved. Again, he can offer no firm evolutionary answer. Notice the guesswork without evidence of a law of nature, raising the perhapsimaybecouldness index outside the bounds of science..." CEH
And God said, Let us make man in our image, after our likeness:
Genesis 1:26
Posted by at

Monday, October 3, 2016

The GREAT CONTROVERSY: Book of Job

Shall he that contendeth with the Almighty instruct him?
he that reproveth God, let him answer it.
Job 40:2
The GREAT CONTROVERSY Played out in JOB

An Accuser: Satan
A Judge: God
The Evidence to be Examined: Case of Job
A Jury: The "Sons of God"
The Accused: GOD Himself
The Verdict: Pronounced at the End of the Book

Get the point?
The Panorama of the GREAT CONTROVERSY we are caught up in is presented.
God Himself is on TRIAL
 
Posted by at
Subscribe to: Posts (Atom)