What sorrow awaits those who argue with their Creator.
Does a clay pot argue with its maker?
Does the clay dispute with the one who shapes it, saying,
‘Stop, you’re doing it wrong!’
Does the pot exclaim,
‘How clumsy can you be?
Does a clay pot argue with its maker?
Does the clay dispute with the one who shapes it, saying,
‘Stop, you’re doing it wrong!’
Does the pot exclaim,
‘How clumsy can you be?
Isaiah 45:9 NLT
"One class of repetitious human genome sequences recently highlighted in the news is called tandem repeats (TRs). These are simply stretches of DNA comprised of two or more contiguous copies of a "word" (called a motif) arranged in a head-to-tail pattern. For example, the TR "ttacttacttacttacgttac" is simply a repeat of the four-base motif "ttac" five times. Amazingly, these TRs are found all over the human genome: inside genes, outside genes, and even
Despite knowing about these TR sequences and using them as reliable genetic markers, scientists have known very little about their actual function. Historically, anomalies like these repeating sequences, that seem to make little sense upon first glance, were often relegated to the trash bin of "junk DNA."
However, one group of researchers recently took a different approach and hypothesized that these sequences may have a purpose. They developed a set of experiments to test the effect of TRs on gene expression and the epigenetic modification of DNA. Epigenetic modification is the addition of molecular tags to the DNA molecule without changing the actual DNA sequence. The result is altered gene expression.
As a consequence of extensive testing using both existing and newly generated data sets, the researchers proclaim, "Our results suggest that there are potentially thousands of TR variants in the human genome that exert functional effects via alterations of local gene expression or epigenetics." They also state,
Our study assigns biological significance to TR variations in the human genome, and suggests that a significant fraction of TR variations exert functional effects via alterations of local gene expression or epigenetics. We conclude that targeted studies that focus on genotyping [genetic testing] TR variants are required to fully ascertain functional variation in the genome.
These new data confirm a variety of previous studies that uncovered evidence of the functional role of TRs from their association with human diseases. As it turns out, several dozen heritable human diseases are directly associated with large repeat expansions in either coding or non-protein-coding regions of the genome.2
Clearly, these regions are under tight genetic control. When the repeats go outside their boundaries of allowable length variation, disease may be the result.
Once more we have a glaring example of demonstrated function in the genome for something once declared non-functional merely based on the fact that scientists didn't know its function—as if a lack of knowledge and understanding could somehow provide an adequate answer.
If a design-based approach were more widely taken during the course of genomic discovery, just think how much improvement would take place in our understanding of currently unknown features. Such an approach would also give glory to our great omnipotent Creator who is the Master Designer and Engineer of all life." ICR